Review



anti trinitrophenol isotype matched control monoclonal antibody  (Bio X Cell)


Bioz Verified Symbol Bio X Cell is a verified supplier
Bioz Manufacturer Symbol Bio X Cell manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 98
      Buy from Supplier

    Structured Review

    Bio X Cell anti trinitrophenol isotype matched control monoclonal antibody
    Anti Trinitrophenol Isotype Matched Control Monoclonal Antibody, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 98/100, based on 1840 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+trinitrophenol+isotype+matched+control+monoclonal+antibody/InVivoMAb+rat+IgG2a+isotype+control%2C+anti-trinitrophenol/pm41923630-579-19-24
    Average 98 stars, based on 1840 article reviews
    anti trinitrophenol isotype matched control monoclonal antibody - by Bioz Stars, 2026-11
    98/100 stars

    Images

    Related Articles

    Control:

    Article Title: Single-cell analysis highlights the significance of malignant cell IFN/MHC-II for immunotherapy response in head and neck squamous cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PE anti-mouse H-2, clone M1/42 Biolegend Cat# 125505; RRID AB_1227706 BV 786 anti-mouse EpCAM, clone G8.8 ThermoFisher Cat# 417-5791-80; RRID AB_3074147 Biological samples Human head and neck squamous cell carcinoma patient samples Washington University N/A Chemicals, peptides, and recombinant proteins Mouse IFN-gamma Recombinant Protein PeproTech Cat# 315-05 Critical commercial assays gentleMACS Octo Dissociator Miltenyi Cat# 130-096-427 Chromium Single Cell 3’ (V2 Chemistry) platform 10X Genomics Cat# PN-120237 Chromium Single Cell 5’ (V2) platform 10X Genomics Cat# PN-1000263 MERCURIUS BRB-seq kit Alithea Genomics Cat# 10813 Deposited data Processed single cell RNA-seq data This paper GEO: GSE301741 Raw single cell RNA-seq data This paper SRA: PRJNA1283925 Raw bulk RNA-seq data Uppaluri et al.36 dbGaP: phs002864 Experimental models: Cell lines Mouse oral cavity 1 (MOC1) cell line Kerafast EWL001-FP Experimental models: Organisms/strains C57BL/6 mice Jackson Laboratories 000664 Oligonucleotides Ifngr1 Alt-R CRISPR-Cas9 sgRNA: GTACCGACGAATGTTCTAAT IDT N/A Ciita Alt-R CRISPR-Cas9 sgRNA: GAGCGCCAGCTAGCCCACGGNGG IDT N/A Software and algorithms CellRanger v3.1.0 10X Genomics https://github.com/10XGenomics/cellranger CellBender v0.2 Fleming et al.47 https://cellbender.readthedocs.io/en/latest/ introduction/index.html scAtlasVAE Xue et al.19 https://scatlasvae.readthedocs.io/en/latest/ CIBERSORTx Steen et al.48 https://cibersortx.stanford.edu/ QuPath v0.6.0-rc3 Bankhead et al.49 https://qupath.readthedocs.io/en/0.6/ InstanSeg Goldsborough et al.50 https://github.com/instanseg/instanseg FlowJo v10.10.0 FlowJo, LLC https://www.flowjo.com/flowjo/overview R v4.3.1 R Core Team51 https://www.R-project.org/ NMF Gaujoux et al.52 https://github.com/renozao/NMF STARsolo v2.7.6a Kaminow et al.53 https://github.com/alexdobin/STAR/blob/master/ docs/STARsolo.md Jupyterlab v4.0.11 Kluyver et al.54 https://github.com/jupyterlab/jupyterlab Seaborn v0.13.2 Waskom et al.55 https://pypi.org/project/seaborn/ Scanpy v1.10.1 Wolf et al.56 https://pypi.org/project/scanpy/ scimap v0.14 Nirmal et al.57 https://scimap-doc.readthedocs.io/en/latest/ Cell Reports Medicine 7, 102715, April 21, 2026 e2 Article ll OPEN ACCESS two doses (cohort 2) of pembrolizumab (200mg, intravenous, every 3 weeks) prior to curative-intent surgical resection and standardof-care adjuvant therapy. .. For immunotherapy, MOC1 tumor-bearing mice received 250 μg per animal per treatment of anti-PD1 monoclonal antibody (BioXcell, BE0146) or anti-trinitrophenol isotype-matched control monoclonal antibody (BioXcell, BE0089) on days 3, 6, and 9 post-engraftment via intra-peritoneal (IP) injection. ..

    Injection:

    Article Title: Single-cell analysis highlights the significance of malignant cell IFN/MHC-II for immunotherapy response in head and neck squamous cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PE anti-mouse H-2, clone M1/42 Biolegend Cat# 125505; RRID AB_1227706 BV 786 anti-mouse EpCAM, clone G8.8 ThermoFisher Cat# 417-5791-80; RRID AB_3074147 Biological samples Human head and neck squamous cell carcinoma patient samples Washington University N/A Chemicals, peptides, and recombinant proteins Mouse IFN-gamma Recombinant Protein PeproTech Cat# 315-05 Critical commercial assays gentleMACS Octo Dissociator Miltenyi Cat# 130-096-427 Chromium Single Cell 3’ (V2 Chemistry) platform 10X Genomics Cat# PN-120237 Chromium Single Cell 5’ (V2) platform 10X Genomics Cat# PN-1000263 MERCURIUS BRB-seq kit Alithea Genomics Cat# 10813 Deposited data Processed single cell RNA-seq data This paper GEO: GSE301741 Raw single cell RNA-seq data This paper SRA: PRJNA1283925 Raw bulk RNA-seq data Uppaluri et al.36 dbGaP: phs002864 Experimental models: Cell lines Mouse oral cavity 1 (MOC1) cell line Kerafast EWL001-FP Experimental models: Organisms/strains C57BL/6 mice Jackson Laboratories 000664 Oligonucleotides Ifngr1 Alt-R CRISPR-Cas9 sgRNA: GTACCGACGAATGTTCTAAT IDT N/A Ciita Alt-R CRISPR-Cas9 sgRNA: GAGCGCCAGCTAGCCCACGGNGG IDT N/A Software and algorithms CellRanger v3.1.0 10X Genomics https://github.com/10XGenomics/cellranger CellBender v0.2 Fleming et al.47 https://cellbender.readthedocs.io/en/latest/ introduction/index.html scAtlasVAE Xue et al.19 https://scatlasvae.readthedocs.io/en/latest/ CIBERSORTx Steen et al.48 https://cibersortx.stanford.edu/ QuPath v0.6.0-rc3 Bankhead et al.49 https://qupath.readthedocs.io/en/0.6/ InstanSeg Goldsborough et al.50 https://github.com/instanseg/instanseg FlowJo v10.10.0 FlowJo, LLC https://www.flowjo.com/flowjo/overview R v4.3.1 R Core Team51 https://www.R-project.org/ NMF Gaujoux et al.52 https://github.com/renozao/NMF STARsolo v2.7.6a Kaminow et al.53 https://github.com/alexdobin/STAR/blob/master/ docs/STARsolo.md Jupyterlab v4.0.11 Kluyver et al.54 https://github.com/jupyterlab/jupyterlab Seaborn v0.13.2 Waskom et al.55 https://pypi.org/project/seaborn/ Scanpy v1.10.1 Wolf et al.56 https://pypi.org/project/scanpy/ scimap v0.14 Nirmal et al.57 https://scimap-doc.readthedocs.io/en/latest/ Cell Reports Medicine 7, 102715, April 21, 2026 e2 Article ll OPEN ACCESS two doses (cohort 2) of pembrolizumab (200mg, intravenous, every 3 weeks) prior to curative-intent surgical resection and standardof-care adjuvant therapy. .. For immunotherapy, MOC1 tumor-bearing mice received 250 μg per animal per treatment of anti-PD1 monoclonal antibody (BioXcell, BE0146) or anti-trinitrophenol isotype-matched control monoclonal antibody (BioXcell, BE0089) on days 3, 6, and 9 post-engraftment via intra-peritoneal (IP) injection. ..



    Similar Products

    anti trinitrophenol isotype matched control monoclonal antibody  (Bio X Cell)
    98
    Bio X Cell anti trinitrophenol isotype matched control monoclonal antibody
    Anti Trinitrophenol Isotype Matched Control Monoclonal Antibody, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+trinitrophenol+isotype+matched+control+monoclonal+antibody/InVivoMAb+rat+IgG2a+isotype+control%2C+anti-trinitrophenol/pm41923630-579-19-24
    Average 98 stars, based on 1 article reviews
    anti trinitrophenol isotype matched control monoclonal antibody - by Bioz Stars, 2026-11
    98/100 stars
    		  Buy from Supplier
    isotype matched control igg2a mab  (Bio X Cell)
    98
    Bio X Cell isotype matched control igg2a mab
    Figure 2. The anti-Ly6G mAb reduced neutrophils in the blood and spleen of C57BL/6J mice in phase I OIR (A). Schematic diagram showing the administration of the isotype control <t>IgG2a</t> mAb and the neutrophil depleting anti-Ly6G mAb during phase I OIR (B). The frequency of neutrophils in the blood and spleen at P12. **** p < 0.0001 according to unpaired t-test. n = 6 to 7 mice per group from two independent experiments. (C) Representative retinal flat-mount images from OIR mice at P12, stained with fluorescein isothiocyanate-conjugated isolectin (green) to visualize blood vessels. Vaso-obliterated (asterisk) and vascularized (V) areas are shown. Scale bar = 150 µm. (D). Quantitation of vaso-obliterated area. *** p < 0.001 according to unpaired t-test. n = 11 to 2 mice per group from three independent experiments. All values are mean ± SEM.
    Isotype Matched Control Igg2a Mab, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+trinitrophenol+isotype+matched+control+monoclonal+antibody/InVivoMAb+rat+IgG2a+isotype+control%2C+anti-trinitrophenol/pm37958664-191-1-5
    Average 98 stars, based on 1 article reviews
    isotype matched control igg2a mab - by Bioz Stars, 2026-11
    98/100 stars
    		  Buy from Supplier

    Image Search Results


    Figure 2. The anti-Ly6G mAb reduced neutrophils in the blood and spleen of C57BL/6J mice in phase I OIR (A). Schematic diagram showing the administration of the isotype control IgG2a mAb and the neutrophil depleting anti-Ly6G mAb during phase I OIR (B). The frequency of neutrophils in the blood and spleen at P12. **** p < 0.0001 according to unpaired t-test. n = 6 to 7 mice per group from two independent experiments. (C) Representative retinal flat-mount images from OIR mice at P12, stained with fluorescein isothiocyanate-conjugated isolectin (green) to visualize blood vessels. Vaso-obliterated (asterisk) and vascularized (V) areas are shown. Scale bar = 150 µm. (D). Quantitation of vaso-obliterated area. *** p < 0.001 according to unpaired t-test. n = 11 to 2 mice per group from three independent experiments. All values are mean ± SEM.

    Journal: International journal of molecular sciences

    Article Title: Early Depletion of Neutrophils Reduces Retinal Inflammation and Neovascularization in Mice with Oxygen-Induced Retinopathy.

    doi: 10.3390/ijms242115680

    Figure Lengend Snippet: Figure 2. The anti-Ly6G mAb reduced neutrophils in the blood and spleen of C57BL/6J mice in phase I OIR (A). Schematic diagram showing the administration of the isotype control IgG2a mAb and the neutrophil depleting anti-Ly6G mAb during phase I OIR (B). The frequency of neutrophils in the blood and spleen at P12. **** p < 0.0001 according to unpaired t-test. n = 6 to 7 mice per group from two independent experiments. (C) Representative retinal flat-mount images from OIR mice at P12, stained with fluorescein isothiocyanate-conjugated isolectin (green) to visualize blood vessels. Vaso-obliterated (asterisk) and vascularized (V) areas are shown. Scale bar = 150 µm. (D). Quantitation of vaso-obliterated area. *** p < 0.001 according to unpaired t-test. n = 11 to 2 mice per group from three independent experiments. All values are mean ± SEM.

    Article Snippet: The isotype-matched control IgG2a mAb (BioXCell, IgG2a, clone 2A3, #BE0089) was administered at the same dose and schedule as the anti-Ly6G mAb.

    Techniques: Control, Staining, Quantitation Assay

    Figure 3. Neutrophil depletion reduced MPO and VEGF levels in the retina of C57BL/6J mice in early phase II OIR (A). Schematic diagram showing the administration of the isotype control IgG2a mAb and the neutrophil depleting anti-Ly6G mAb during phase I and II OIR (B). MPO expression via Western blotting at P13 (C). VEGF protein levels via ELISA at P13. * p < 0.05, ** p < 0.01, **** p < 0.0001, and ns, non-significant according to one-way ANOVA followed by Tukey’s multiple comparisons test. n = 6 to 7 mice per group. All values are mean ± SEM.

    Journal: International journal of molecular sciences

    Article Title: Early Depletion of Neutrophils Reduces Retinal Inflammation and Neovascularization in Mice with Oxygen-Induced Retinopathy.

    doi: 10.3390/ijms242115680

    Figure Lengend Snippet: Figure 3. Neutrophil depletion reduced MPO and VEGF levels in the retina of C57BL/6J mice in early phase II OIR (A). Schematic diagram showing the administration of the isotype control IgG2a mAb and the neutrophil depleting anti-Ly6G mAb during phase I and II OIR (B). MPO expression via Western blotting at P13 (C). VEGF protein levels via ELISA at P13. * p < 0.05, ** p < 0.01, **** p < 0.0001, and ns, non-significant according to one-way ANOVA followed by Tukey’s multiple comparisons test. n = 6 to 7 mice per group. All values are mean ± SEM.

    Article Snippet: The isotype-matched control IgG2a mAb (BioXCell, IgG2a, clone 2A3, #BE0089) was administered at the same dose and schedule as the anti-Ly6G mAb.

    Techniques: Control, Expressing, Western Blot, Enzyme-linked Immunosorbent Assay